Skip to content

bzhanglab/PepQueryMHC

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

PepQueryMHC



About

The accurate prioritization of tumor antigens, including aberrant translational products, is critical for the development of personalized cancer immunotherapies. PepQueryMHC estimates a comprehensive repertoire of local RNA expression of tumor antigens within minutes per sample.

Usage

PepQueryMHC provides three main functions such as 1) scan mode, 2) target mode 3) FASTQ mode and 4) annotate mode.
When you use FASTQ mode, please make sure that FASTQ files do not contain artifical sequences such as adaptors, barcodes and so on.

Quick start

Scan mode

java -Xmx2G -jar PepQueryMHC.jar \
--mode scan \
--input peptides.tsv \
--bam sample.sorted.bam \
--output sample \
--thread 16

Target mode

java -Xmx2G -jar PepQueryMHC.jar \
--mode target \
--input peptides_locations_strands.tsv \
--bam sample.sorted.bam \
--output sample \
--thread 16

FASTQ mode (for single-end)

java -Xmx2G -jar PepQueryMHC.jar \
--mode fastq \
--input peptides.tsv \
--0 sample.trimmed.fastq.gz \
--output sample \
--strand f \
--thread 16

FASTQ mode (for paired-end)

java -Xmx2G -jar PepQueryMHC.jar \
--mode fastq \
--input peptides.tsv \
--1 sample.trimmed.fastq.1.gz \
--2 sample.trimmed.fastq.2.gz \
--output sample \
--strand rf \
--thread 16

Annotate mode

java -Xmx2G -jar PepQueryMHC.jar \
--mode annotate \
--input locations_strands.tsv \
--gtf reference_annotation.gtf \
--output sample

Parameters

Y+: mandatory, Y: optional, N: none

Option Description Type Default Scan mode Target mode FASTQ mode Annotate mode
m/mode mode to use scan|target|fastq|annotate Y+ Y+ Y+ Y+
i/input input file path string Y+ Y+ Y+ Y+
o/output output base name path string Y+ Y+ Y+ Y+
b/bam sorted bam/sam file path bam|sam Y+ Y+ N N
0/fastq_single fastq file path fastq|fastq.gz N N Y+ N
1/fastq_paired_1 fastq file path fastq|fastq.gz N N Y+ N
2/fastq_paried_2 fastq file path fastq|fastq.gz N N Y+ N
g/gtf gtf file path string N N N Y+
@/thread the number of threads int 4 Y Y Y N
c/count tpye of reads being processed primary|all primary Y Y N N
l/lib_size tsv file including library size information string Y Y Y N
w/white_list cell brcode list (tsv), only available in single-cell RNA-seq string Y Y Y N
p/prob ignore region of interests with error > p [0,1] 0.05 Y Y Y N
e/equal specify isoleucine = leucine none Y Y Y N
u/union specify the unit of the peptide read count sum|max sum Y Y N N
s/strand specify strandedness. non: non-stranded, fr: fr-second strand, rf: fr-first strand, f: forward strand for single-end, r: reverse strand for single-end, auto: auto-detection. Auto-detection is only available if there is XS tag in a given bam file non|fr|rf|f|r|auto auto Y Y Y+ N
s/stretch output single line per annotation none N N N Y
v/verbose print every messages being processed none Y Y Y Y

Scan mode

Input format

Sequence User-defined column 1 ... User-defined column N
AACTKLAKKM any value ... any value

Target mode

Input format

Sequence Location Strand User-defined column 1 ... User-defined column N
AACTKLAKKM chr1:1-30 + any value ... any value
TKMQEPPALY chr1:31-50|chr1:81-90 - any value ... any value
KEKRKAPPR . . any value ... any value

FASTQ mode

Input format

Sequence User-defined column 1 ... User-defined column N
AACTKLAKKM any value ... any value
  • input format is exactly the same as what used in scan mode.

Annotate mode

Input format

Location Strand User-defined column 1 ... User-defined column N
chr1:1-30 + any value ... any value
chr1:31-50|chr1:81-90 - any value ... any value
chr1:21-40|chr1:87-90 . any value ... any value

White list

A white list is a set of barcodes selected for inclusion in the analysis of single-cell RNA-seq data.
Input format

Barcode
AAACCTGAGCAATCTC-1
AAACCTGAGCGTTTAC-1
AAACCTGAGCTGCAAG-1
AAACCTGCAAACGTGG-1
AAACCTGCAAACTGCT-1
AAACCTGCAACTGGCC-1
AAACCTGCAAGCCCAC-1
AAACCTGCACTTAAGC-1
AAACCTGCAGCCACCA-1

Output

PepQueryMHC provides four modes (scan, fastq, target, and annotate modes) and generates different levels of transcriptomic annotations.

scan.tsv

This format is generated in both scan and fastq modes and contains detailed level of transcriptomic features.

Column Description Example Scan mode FASTQ mode
Matched_location Matched genomic location chr16:84101848-84101874 Y N
Matched_mutations Nucleotide variants including SNV and INDEL chr16:84101848A>T Y N
Matched_strand RNA strand - Y N
Matched_peptide Translated nucleotide sequence directly from the input NGS LLAETKIHL Y Y
Matched_nucleotide Nucleotide sequence directly from the input NGS TAAGTGAATTTTTGTTTCAGCTAAAAG Y Y
Matched_reference_nucleotide Reference nucleotide sequence of a given genomic region aAAGTGAATTTTTGTTTCAGCTAAAAG Y N
Matched_read_count The number of reads supporting the match 91 Y Y
Matched_RPHM Normalized read count supporting tha match 32.6392389935464 Y Y
Proportion Proportion of this annotation among all reads matching the input peptide sequence 0.947916666666666 Y Y

target.tsv

This format is generated in target mode.

Column Description Example
Matched_location Matched genomic location chr16:84101848-84101874
Matched_mutations Nucleotide variants including SNV and INDEL chr16:84101848A>T
Matched_strand RNA strand -
Matched_peptide Translated nucleotide sequence directly from the input NGS LLAETKIHL
Matched_nucleotide Nucleotide sequence directly from the input NGS TAAGTGAATTTTTGTTTCAGCTAAAAG
Matched_reference_nucleotide Reference nucleotide sequence of a given genomic region aAAGTGAATTTTTGTTTCAGCTAAAAG
Matched_read_count The number of reads supporting the match 91
Matched_RPHM Normalized read count supporting tha match 32.6392389935464
Proportion Proportion of this annotation among all reads matching the input peptide sequence 0.978494623655914

gloc.tsv

This format is generated in both scan and target modes. It summarizes matches at the genomic location level, regardless of mutations

Column Description Example Scan mode Target mode
Matched_peptide Translated nucleotide sequence directly from the input NGS LLAETKIHL Y Y
Matched_location Matched genomic location chr16:84101848-84101874 Y Y
Matched_strand RNA strand - Y Y
Matched_read_count The number of reads supporting the match regardless of mutations 93 Y Y
Matched_RPHM Normalized read count supporting tha match regradless of mutations 33.3565849054925 Y Y
Proportion Proportion of this annotation among all reads matching the input peptide sequence 0.96875 Y Y

peptide.tsv

This format is generated in both scan and target modes. It summarizes matches at the peptide level.

Column Description Example Scan mode Target mode
Matched_peptide(sum) Translated nucleotide sequence directly from the input NGS LLAETKIHL Y Y
Abundant_location The most abundant genomic location among all matched locations chr16:84101848-84101874 Y Y
Abundant_strand RNA strand of the most abundant genomic location - Y Y
Proportion Proportion of this annotation among all reads matching the input peptide sequence 0.96875 Y Y
Matched_num_locations The number of matched genomic locations 2 Y Y
Matched_read_count Sum of the number of reads supporting the matches 96 Y Y
Matched_RPHM Normalized read count supporting tha sum of matches 34.4326037734116 Y Y

annotate.tsv

This format is generated in annotate mode.

Column Description Example
Annotation_count The number of possible annotations based on a given gene model 1
Gene_id Gene id of a given genomic location ENSG00000140943.18
Gene_name Gene name of a given genomic location MBTPS1
Gene_strand Gene strand -
Gene_type Gene type protein_coding
Class_code It assigns events, detailed in below 5`-UTR
Unique_class_code It only reports unique class code by removing duplications 5`-UTR
Warning_tag It reports a warning if the gene annotation is incomplete .

Class_code
-- In-frame (IF)
-- Out-of-frame (OOF)
-- Non-coding RNA (ncRNA)
-- 5`-untranslated-region (5`-UTR)
-- 3`-untranslated-region (3`-UTR)
-- Intron-retention (IR)
-- Antisense RNA (asRNA)
-- Intergenic-region (IGR)
-- Exon-skipping (ES)
-- Alternative-splicing-site (ASS)
-- Unknown

Figures for the reviewers

Figures in the paper can be generated using: 1) R code in figR folder, 2) Supplementary Tables 1,2,3, and 5, and 3) the meta dataset available at https://doi.org/10.5281/zenodo.17429717.

Cite

Seunghyuk Choi and Bing Zhang. PepQueryMHC: rapid and comprehensive tumor antigen prioritization from immunopeptidomics data. Genome Biology 26, 434 (2025).

License

All code is available as under the GNU General Public License v3.0.

About

PepQueryMHC: Rapid and Comprehensive Tumor Antigen Prioritization from Immunopeptidomics Data

Topics

Resources

License

Stars

Watchers

Forks

Packages

No packages published