A notebook that creates an example of an SBOL2 Component

examples/sbol2/CreatingSBOL2Objects/Component.ipynb

@@ -0,0 +1,171 @@
+{
+ "cells": [
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "# Introduction\n",
+    "\n",
+    "A `Component` is used to compose `ComponentDefinition` objects into a structural hierarchy. For example, the `ComponentDefinition` of a gene could contain four `Component` objects: a promoter, RBS, CDS, and terminator. In turn, the `ComponentDefinition` of the promoter `Component` could contain Component objects defined as various operator sites.\n",
+    "\n",
+    "`Component` objects have the following properties of note:\n",
+    "\n",
+    "- `definition`:  Identifies the `ComponentDefinition` that provides the detailed description or blueprint for the Component. It is `MANDATORY`.\n",
+    "\n",
+    "- `roles`: describes the expected purpose and function of the component. Used when the `role` of the component differes from that of the `sub-componentDefinition`. For example, A component Definition that is an activator is being used as a repressor. \n",
+    "\n",
+    "- `roleIntegration`: Specifies the relationship between a Component instance’s own set of roles and the set of roles on the included sub-ComponentDefinition. It is only mandatory to set if one or more `roles` are set. It can be set to:\n",
+    "    1. `SBOL_ROLE_INTEGRATION_MERGE`: This option combines the roles from both the current Component and the included sub-ComponentDefinition, resulting in the union of their roles​. It is the default.\n",
+    "    2. `SBOL_ROLE_INTEGRATION_OVERRIDE`: This option instructs that any roles specified for the included sub-ComponentDefinition should be ignored, and only the roles explicitly defined for the current Component should be used.\n",
+    "\n",
+    "- `sourceLocations`: Indicates which elements of a `ComponentDefinition`'s `Sequence` are to be included in the `Component`'s Parent. It is optional. If it is not set, the whole `Sequence` is assumed to be included.\n",
+    "\n",
+    "- `mapsTo`: Defines relationships between `Component` objects in different contexts, such as hierarchical designs. For details, see the `MapsTo` Notebook.\n",
+    "\n",
+    "- `access`: the access property of a Component controls whether it can be referenced by other components or modules through a `MapsTo` object. There are two options:\n",
+    "\n",
+    "    1. `SBOL_ACCESS_PUBLIC`: The component is visible and accessible to other designs, meaning it can be used in different parts of a larger system.\n",
+    "    2. `SBOL_ACCESS_PRIVATE`: The component is only accessible within the design it belongs to and cannot be used by external components.\n",
+    "\n",
+    "- `measures`: The measures property is OPTIONAL and MAY contain a set of Measure objects. For details, see the `Measures` Notebook.\n",
+    "\n",
+    "For more information on the `Component` class and its properties, check out page 28 of the SBOL 2.3.0 specifications, which can be found at the following [link](https://sbolstandard.org/docs/SBOL2.3.0.pdf)."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 7,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# import dependency\n",
+    "import sbol2\n",
+    "\n",
+    "# Create the document and set the namespace\n",
+    "doc = sbol2.Document()\n",
+    "sbol2.setHomespace('https://github.com/SynBioDex/SBOL-Notebooks')\n",
+    "\n",
+    "# Create a Sequence object for the genetic construct\n",
+    "genetic_construct_sequence = sbol2.Sequence('genetic_construct_sequence')\n",
+    "genetic_construct_sequence.elements = 'ATGCGTACGATCGTAAAGAGGAGAAAATGCGTACGTAGCTAGTCTGATCGTAGCTAGTTGGCTCTGGTTTACTGGGCG'\n",
+    "genetic_construct_sequence.encoding = sbol2.SBOL_ENCODING_IUPAC\n",
+    "doc.addSequence(genetic_construct_sequence)\n",
+    "\n",
+    "# Create a ComponentDefinition object to house the genetic construct sequence\n",
+    "genetic_construct_cd = sbol2.ComponentDefinition('genetic_construct_component_definition', component_type=sbol2.BIOPAX_DNA)\n",
+    "genetic_construct_cd.addRole(sbol2.SBO_GENE)\n",
+    "genetic_construct_cd.sequence = genetic_construct_sequence\n",
+    "doc.addComponentDefinition(genetic_construct_cd)\n",
+    "\n"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "## Steps in Creating A `Component`"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 8,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# --- First Component: Promoter ---\n",
+    "# Step 1: Ceate a ComponentDefinition object for the promoter\n",
+    "promoter_component_definition = sbol2.ComponentDefinition('promoter_component_definition', component_type=sbol2.BIOPAX_DNA)\n",
+    "promoter_component_definition.addRole(sbol2.SO_PROMOTER)\n",
+    "doc.addComponentDefinition(promoter_component_definition)\n",
+    "\n",
+    "# Step 2: Create a Component object for the promoter\n",
+    "promotor_component = sbol2.Component('promoter_comoponent')\n",
+    "\n",
+    "# Step 3: Connect the Component object to the ComponentDefinition object through the definition property\n",
+    "promotor_component.definition = promoter_component_definition\n",
+    "\n",
+    "# Step 4: Add the Component to the the components list in the parent ComponentDefinition\n",
+    "genetic_construct_cd.components.add(promotor_component)"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "We can also specify which elements of the gene-construct `ComponentDefinition` is to be included in the promoter. Let us say that the promoter spans the first 26 DNA nucleotides of the gene-construct."
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 9,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "\n",
+    "# Create a range objects to specify the location of the promotor on the genetic construct sequence\n",
+    "promotor_range = sbol2.Range('promoter_range', start=1, end=26)\n",
+    "promotor_component.sourceLocations.add(promotor_range)"
+   ]
+  },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "## Creating the CDS `Component`\n",
+    "We will now create a second Sub-Component for the gene-construct: A CDS. "
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": 10,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "\n",
+    "# --- Second Component: CDS ---\n",
+    "# Step 1: Ceate a ComponentDefinition object for the promoter\n",
+    "cds_component_definition = sbol2.ComponentDefinition('cds_component_definition', component_type=sbol2.BIOPAX_DNA)\n",
+    "cds_component_definition.addRole(sbol2.SO_CDS)\n",
+    "\n",
+    "doc.addComponentDefinition(cds_component_definition)\n",
+    "\n",
+    "# Step 2: Create a Component object for the promoter\n",
+    "cds_component = sbol2.Component('cds_component')\n",
+    "\n",
+    "# Step 3: Connect the Component object to the ComponentDefinition object through the definition property\n",
+    "cds_component.definition = cds_component_definition\n",
+    "\n",
+    "# Step 4: Add the Component to the the components list in the parent ComponentDefinition\n",
+    "genetic_construct_cd.components.add(cds_component)\n",
+    "\n",
+    "\n",
+    "# Check if the SBOL document is valid\n",
+    "doc.validate()\n",
+    "\n",
+    "# Save the document to an SBOL file\n",
+    "doc.write('component_example.xml')"
+   ]
+  }
+ ],
+ "metadata": {
+  "kernelspec": {
+   "display_name": "SBOL-test",
+   "language": "python",
+   "name": "python3"
+  },
+  "language_info": {
+   "codemirror_mode": {
+    "name": "ipython",
+    "version": 3
+   },
+   "file_extension": ".py",
+   "mimetype": "text/x-python",
+   "name": "python",
+   "nbconvert_exporter": "python",
+   "pygments_lexer": "ipython3",
+   "version": "3.10.14"
+  }
+ },
+ "nbformat": 4,
+ "nbformat_minor": 2
+}